View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-139 (Length: 48)
Name: NF4336-Insertion-139
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-139 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.000000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.000000000000003
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 29989068 - 29989024
Alignment:
| Q |
4 |
acttgcccaaccttcttcaatcatttcatcaattacattttctga |
48 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29989068 |
acttgcccaactttcttcaatcatttcatcaattacattttctga |
29989024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University