View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4336-Insertion-141 (Length: 138)

Name: NF4336-Insertion-141
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4336-Insertion-141
NF4336-Insertion-141
[»] chr7 (1 HSPs)
chr7 (24-74)||(11478730-11478780)


Alignment Details
Target: chr7 (Bit Score: 47; Significance: 3e-18; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 24 - 74
Target Start/End: Original strand, 11478730 - 11478780
Alignment:
24 atcatatccaaaagaatcaaaccagatagattgatatatgcatggatggat 74  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||    
11478730 atcatatccaaaagaatcaaaccagatagattgatatatgcattgatggat 11478780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University