View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-145 (Length: 133)
Name: NF4336-Insertion-145
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-145 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 5 - 133
Target Start/End: Complemental strand, 28191547 - 28191419
Alignment:
| Q |
5 |
ccaattgagattccaaattagaattacggacaacattgctcaaaaataccttaattagctcaaagttttctttgtcgatgatagagataacctgctgcca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28191547 |
ccaattgagattccaaattagaattacggacaacattgctcaaaaataccttaattagctcaaagttttctttgtcgatgatagagataacctgttgcca |
28191448 |
T |
 |
| Q |
105 |
aatatttgctgtctatgttctatgcactt |
133 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
28191447 |
aatatttgttgtctatgttctatgcactt |
28191419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University