View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-21 (Length: 224)
Name: NF4336-Insertion-21
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 8 - 196
Target Start/End: Original strand, 1288896 - 1289084
Alignment:
| Q |
8 |
gatatgtattgtaaatttaggaaatcatgaactagaaggaaaataaagacttcaagtctaaaccttcccagcccagtaaatgtatcccaaataataatgc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1288896 |
gatatgtattgtaaatttaggaaatcatgaaccagaaggaaaataaagacttcaagtctaaaccatcccagcccagtaaatgtatcccaaataataatgc |
1288995 |
T |
 |
| Q |
108 |
ttgaaaaataattagttattcaatagtaatacattaagctagtttattgtatggaattgattaacatcattaagattggatatgagcaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1288996 |
ttgaaaaataattagttattcaatagtaatacattaagctagtttattgcatggaattgattaacatcattaagattggatatgagcaa |
1289084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University