View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-22 (Length: 160)
Name: NF4336-Insertion-22
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-22 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 7e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 7e-69
Query Start/End: Original strand, 5 - 160
Target Start/End: Original strand, 30811728 - 30811883
Alignment:
| Q |
5 |
agaaatgagtcaaggggaagcatagaacatagtagaaattatcactccacaaggaaaatgaaaccaaagaagtttcatcatgtttccatcatgggagatg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30811728 |
agaaatgagtcaaggggaagcatagaacatagtagaaattatcactccacgaggaaaatgaaaccaaagaagtgtcatcatgtttccatcatgggagatg |
30811827 |
T |
|
| Q |
105 |
agtgcattgatatcatcagaaagaaagatgacacattttcgattcagccgattcga |
160 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
30811828 |
agtgcattaatattatcagaaagaaagatgaaacattttcgatccagccgattcga |
30811883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University