View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-23 (Length: 244)
Name: NF4336-Insertion-23
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-23 |
 | |
|
| [»] scaffold1557 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold1557 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold1557
Description:
Target: scaffold1557; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 55 - 297
Alignment:
| Q |
1 |
acaaggaggaaaa-tcaaattcaaccttttaaaatttcaatcaaactcttcatgttgctttccacagaggaagaataatctaattcaccactcatgacta |
99 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55 |
acaaggaggaaaaatcaaattcaaccttttaaaatttcaatcaaactcttcatgttgctttccacagaggaagaataatctaattcaccactcatgacta |
154 |
T |
|
| Q |
100 |
atttgggtgacattgaaaattcactttgtaacccataatttaattcacccttcataactactttggatgaaatttttaaattcacagcaacgatatggtg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
155 |
atttgggtgacattgaaaattcactttgtaacccataatttaattcacccttcataactactttggatgaaa-ttttaaattcacagcaacgatatggtg |
253 |
T |
|
| Q |
200 |
atatgattttttgatagggagagatgatggtggtgaagacatttc |
244 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
254 |
atatga-tttttgatagggagagatgatggtggtgaagacatttc |
297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University