View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-24 (Length: 63)
Name: NF4336-Insertion-24
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-24 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 5e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 5e-18
Query Start/End: Original strand, 2 - 63
Target Start/End: Original strand, 30811261 - 30811321
Alignment:
| Q |
2 |
actggaaccaagttaacccaacgagatggattttcagtccttcgagttcgacagaacgagga |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
30811261 |
actggaaccaagttaacccaacgagatgga-tttcggttcttcgagttcgacagaacgagga |
30811321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University