View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4336-Insertion-26 (Length: 179)

Name: NF4336-Insertion-26
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4336-Insertion-26
NF4336-Insertion-26
[»] scaffold0013 (1 HSPs)
scaffold0013 (89-179)||(102281-102371)
[»] chr4 (3 HSPs)
chr4 (91-179)||(154294-154382)
chr4 (91-176)||(10307782-10307867)
chr4 (91-179)||(100415-100503)
[»] chr7 (1 HSPs)
chr7 (86-179)||(13041209-13041302)
[»] chr8 (3 HSPs)
chr8 (91-178)||(5680977-5681064)
chr8 (91-178)||(5701030-5701117)
chr8 (91-178)||(5731619-5731706)
[»] chr3 (1 HSPs)
chr3 (92-176)||(12143133-12143217)


Alignment Details
Target: scaffold0013 (Bit Score: 91; Significance: 2e-44; HSPs: 1)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 89 - 179
Target Start/End: Complemental strand, 102371 - 102281
Alignment:
89 gaaagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagta 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
102371 gaaagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagta 102281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 65; Significance: 8e-29; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 8e-29
Query Start/End: Original strand, 91 - 179
Target Start/End: Original strand, 154294 - 154382
Alignment:
91 aagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagta 179  Q
    |||||||||| ||||||||||||||||||||||||| | |||||||||||||| |||||||  ||||||||||||||||||||||||||    
154294 aagatgtggaagctgaagatagcagaaggtgggaatgagccatacttattcagcacaaatagttttgtgggaagacaaacatgggagta 154382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 91 - 176
Target Start/End: Complemental strand, 10307867 - 10307782
Alignment:
91 aagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatggga 176  Q
    |||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||| || | |||||| || |||||||||||    
10307867 aagatgtggaagctgaagatagcagaaggtgggaatgacccatacttattcagcacaaacaattctgtggggagccaaacatggga 10307782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 7e-17
Query Start/End: Original strand, 91 - 179
Target Start/End: Original strand, 100415 - 100503
Alignment:
91 aagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagta 179  Q
    |||||||||| ||||||||| | ||| ||   |||| | |||||||||||||| |||||||| ||||||||||||||||||||||||||    
100415 aagatgtggaagctgaagattggagagggaaagaatgagccatacttattcagcacaaataattttgtgggaagacaaacatgggagta 100503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 86 - 179
Target Start/End: Original strand, 13041209 - 13041302
Alignment:
86 aaagaaagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagta 179  Q
    ||||||||||||||||| ||||||||||||| ||||| ||| |||||||| ||||||| ||||| |||||||| |||||||||| |||||||||    
13041209 aaagaaagatgtggaggttgaagatagcagatggtggtaatgacccatacatattcagcacaaacaactttgtaggaagacaaatatgggagta 13041302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 56; Significance: 2e-23; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 91 - 178
Target Start/End: Complemental strand, 5681064 - 5680977
Alignment:
91 aagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagt 178  Q
    |||||||||||||||||||||||||| ||||||||  | |||||| ||||||||||||||||||||||||| || || ||||||||||    
5681064 aagatgtggaggctgaagatagcagatggtgggaaggatccatacatattcagtacaaataactttgtggggaggcagacatgggagt 5680977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 91 - 178
Target Start/End: Complemental strand, 5701117 - 5701030
Alignment:
91 aagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagt 178  Q
    |||||||||||||||||||||||||| || |||||| | |||||| |||||||||||||||||||| | || || || ||||||||||    
5701117 aagatgtggaggctgaagatagcagatggggggaatgatccatacatattcagtacaaataactttttagggaggcagacatgggagt 5701030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 91 - 178
Target Start/End: Complemental strand, 5731706 - 5731619
Alignment:
91 aagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagt 178  Q
    |||||||||||||||||||||||||| || |||||| | ||| || |||||||||||||||||||| | || || || ||||||||||    
5731706 aagatgtggaggctgaagatagcagatggggggaatgatccacacatattcagtacaaataactttttagggaggcagacatgggagt 5731619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 7e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 7e-17
Query Start/End: Original strand, 92 - 176
Target Start/End: Complemental strand, 12143217 - 12143133
Alignment:
92 agatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatggga 176  Q
    ||||||||||||| ||||||||||| ||||||||  |||| ||| ||||||  |||||||||||||| |||||||| ||||||||    
12143217 agatgtggaggcttaagatagcagatggtgggaaggacccttacatattcaccacaaataactttgtaggaagacagacatggga 12143133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University