View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-29 (Length: 50)
Name: NF4336-Insertion-29
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-29 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.0000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.0000000000008
Query Start/End: Original strand, 14 - 50
Target Start/End: Original strand, 48980529 - 48980565
Alignment:
| Q |
14 |
gtatttgcataagtctctatacctagctattaattcc |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48980529 |
gtatttgcataagtctctatacctagctattaattcc |
48980565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University