View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-32 (Length: 169)
Name: NF4336-Insertion-32
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 4e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 4e-24
Query Start/End: Original strand, 6 - 66
Target Start/End: Complemental strand, 1396156 - 1396096
Alignment:
| Q |
6 |
aaattaccactaattcctatcgagcgacattcagaattagttgtcgaacaagtaactcgac |
66 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1396156 |
aaattaccactaattcctatcgagccacattcagaattagttgtcgaacaagtaactcgac |
1396096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 136 - 169
Target Start/End: Complemental strand, 1395986 - 1395953
Alignment:
| Q |
136 |
caatcgagacatgttttattatccatgcatgtga |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1395986 |
caatcgagacatgttttattatccatgcatgtga |
1395953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University