View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4336-Insertion-32 (Length: 169)

Name: NF4336-Insertion-32
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4336-Insertion-32
NF4336-Insertion-32
[»] chr4 (2 HSPs)
chr4 (6-66)||(1396096-1396156)
chr4 (136-169)||(1395953-1395986)


Alignment Details
Target: chr4 (Bit Score: 57; Significance: 4e-24; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 4e-24
Query Start/End: Original strand, 6 - 66
Target Start/End: Complemental strand, 1396156 - 1396096
Alignment:
6 aaattaccactaattcctatcgagcgacattcagaattagttgtcgaacaagtaactcgac 66  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
1396156 aaattaccactaattcctatcgagccacattcagaattagttgtcgaacaagtaactcgac 1396096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 136 - 169
Target Start/End: Complemental strand, 1395986 - 1395953
Alignment:
136 caatcgagacatgttttattatccatgcatgtga 169  Q
    ||||||||||||||||||||||||||||||||||    
1395986 caatcgagacatgttttattatccatgcatgtga 1395953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University