View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-33 (Length: 143)
Name: NF4336-Insertion-33
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-33 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 4e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 4e-73
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 40066646 - 40066788
Alignment:
| Q |
1 |
gttatattgaattatttctttgctttcatcattttgggtttgatgttaattaagaatgattataaaatcaagaggcatagccggcaacccacgatagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40066646 |
gttatattgaattatttctttgctttcatcattttgggtttgatgttaattaagaatgattataaaatcaagaggcatagccggcaacccacgatagaaa |
40066745 |
T |
 |
| Q |
101 |
ctaaaaatgtcacggatactctctttcactcacattattagtt |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40066746 |
ctaaaaatgtcacggatactctcttttactcacattattagtt |
40066788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University