View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4336-Insertion-36 (Length: 78)

Name: NF4336-Insertion-36
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4336-Insertion-36
NF4336-Insertion-36
[»] chr2 (1 HSPs)
chr2 (1-77)||(33323025-33323101)
[»] chr1 (2 HSPs)
chr1 (1-77)||(1041434-1041510)
chr1 (1-77)||(41199746-41199822)


Alignment Details
Target: chr2 (Bit Score: 77; Significance: 2e-36; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 2e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 33323101 - 33323025
Alignment:
1 ctgattactacagtagcaagagagaagagcttatgtgtttacctcgcgaagcaaagataatttacatttatattttt 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33323101 ctgattactacagtagcaagagagaagagcttatgtgtttacctcgcgaagcaaagataatttacatttatattttt 33323025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 77; Significance: 2e-36; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 2e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 1041510 - 1041434
Alignment:
1 ctgattactacagtagcaagagagaagagcttatgtgtttacctcgcgaagcaaagataatttacatttatattttt 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1041510 ctgattactacagtagcaagagagaagagcttatgtgtttacctcgcgaagcaaagataatttacatttatattttt 1041434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 77; E-Value: 2e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 41199822 - 41199746
Alignment:
1 ctgattactacagtagcaagagagaagagcttatgtgtttacctcgcgaagcaaagataatttacatttatattttt 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41199822 ctgattactacagtagcaagagagaagagcttatgtgtttacctcgcgaagcaaagataatttacatttatattttt 41199746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University