View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-4 (Length: 168)
Name: NF4336-Insertion-4
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 28 - 165
Target Start/End: Complemental strand, 8093225 - 8093088
Alignment:
| Q |
28 |
cacccctcaaaaa-tacttgtaaaatatcaaaattgtaccaaccgaatcccctagtatctcaattatttgttagagttatctttccttcattaaccgtct |
126 |
Q |
| |
|
||||||||||||| ||||| |||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8093225 |
cacccctcaaaaaatacttctaaa-tatcaaaattgtaccaactgaatcccctagtatctcaattatttgttagggttatctttccttcattaaccgtct |
8093127 |
T |
 |
| Q |
127 |
actacttcctctctttttataaacacccttttactcggg |
165 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
8093126 |
actacttcgtctctttttataaacacctttttactcggg |
8093088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University