View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-46 (Length: 46)
Name: NF4336-Insertion-46
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 39; Significance: 0.00000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.00000000000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 30617335 - 30617297
Alignment:
| Q |
1 |
gtttagtcatggtagaatatcttactgtgaattttgggg |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30617335 |
gtttagtcatggtagaatatcttactgtgaattttgggg |
30617297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University