View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-6 (Length: 102)
Name: NF4336-Insertion-6
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 1e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 1e-29
Query Start/End: Original strand, 10 - 99
Target Start/End: Complemental strand, 46635190 - 46635101
Alignment:
| Q |
10 |
ttgtttagtttggtgcgtactgtttaacatatcagacatactcttcatccttttaatttaattactttactttctccttaacttttaaac |
99 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46635190 |
ttgtttaatttggtacgtactgtttaacatattagacgtactcttcgtccttttaatttaattactttactttctccttaacttctaaac |
46635101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University