View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-64 (Length: 244)
Name: NF4336-Insertion-64
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-64 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 49299453 - 49299215
Alignment:
| Q |
1 |
gaattaacgtctccttggttttttctattagtaaaagacacatttcatttttatttttgtgcttattggtatgcagagtgttgttttaggcgacttcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49299453 |
gaattaacgtctccttggttttttctattagtaaaagacacatttcattttt------gtgcttattggtatgcagagtgttgttttaggtgacttcttc |
49299360 |
T |
|
| Q |
101 |
ttcgattgggtctatgaatctcgtttcttgtctccgttagctttctatatcctttagattccaataaatgggttaaaagataaaatgtcaaa----ttat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49299359 |
---gattgggtctatgaatctcgtttcttgtctccgttagctttctatatcctttagattccaataaatgggttaaaagataaaatgtcaaattatttat |
49299263 |
T |
|
| Q |
197 |
atacccaaccgtcaaactaaatacttgtaatattttaataaagttcat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49299262 |
atacccaaccgtcaaactaaatacttgtaatattttaataaagttcat |
49299215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University