View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-65 (Length: 151)
Name: NF4336-Insertion-65
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-65 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 31349319 - 31349470
Alignment:
| Q |
1 |
ctttccacttaaagacacaccacatgcactctttgtttttggtatatattcaatggtcttaatatttttaaagt-nnnnnnnnnnnngttaactttattt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31349319 |
ctttccacttaaagacacaccacatgcactctttgtttttggtatatattcaatggtcttaatatttttaaagtaaaaaaagaaaaagttaactttattt |
31349418 |
T |
|
| Q |
100 |
ggttttgctttgaactttccgattggaacgagcatggaaccctacgcagctt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31349419 |
ggttttgctttgaactttccgattggaacgagcatggaaccctacgcagctt |
31349470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University