View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-68 (Length: 188)
Name: NF4336-Insertion-68
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-68 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 1e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 4 - 141
Target Start/End: Original strand, 30928726 - 30928862
Alignment:
| Q |
4 |
agatggttattggaatgaaatgtggagagtcttggcaccaccaagagtgagacacctatttttgagggtgtttcaggggctgcattctgactcgacagaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30928726 |
agatggttattggaatgaaatgtggagagtcttggcaccaccaagagtgag-cacctatttttgagggtgtttcaggggctgcattctgactcgacagaa |
30928824 |
T |
|
| Q |
104 |
aaagattcagaaaattgtacaatgttcttctagttgct |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30928825 |
aaagattcagaaaattgtacaatgttcttctagttgct |
30928862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000004
Query Start/End: Original strand, 145 - 186
Target Start/End: Original strand, 30928887 - 30928928
Alignment:
| Q |
145 |
ataagatgcaggttctttgagtgtgagaagatggagtgttgg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30928887 |
ataagatgcaggttctttgagtgtgagaagatggagtgttgg |
30928928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University