View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-8 (Length: 91)
Name: NF4336-Insertion-8
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-8 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 6e-34; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 6e-34
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 38121716 - 38121627
Alignment:
| Q |
1 |
taaccgtcacttccgagtcgattcatccgaacaanacttccggcagtgctccnaaagtacttcatcggaggcgttgagattactcaaccgg |
91 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38121716 |
taaccgtcacttccgagtcgattcatcagaacaacacttccggcagtgctccaaaagt-cttcatcggaggcgttgagattactcaaccgg |
38121627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 38608407 - 38608496
Alignment:
| Q |
1 |
taaccgtcacttccgagtcgattcatccgaacaanacttccggcagtgctccnaaagtacttcatcggaggcgttgagattactcaaccgg |
91 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||| ||| ||||| ||||||| ||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
38608407 |
taaccgtcacttccgattcgattcattcgaacattactaccggcggtgctccaaaagt-tttcatcggaggcgttgagattgctcaaccgg |
38608496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 38793190 - 38793279
Alignment:
| Q |
1 |
taaccgtcacttccgagtcgattcatccgaacaanacttccggcagtgctccnaaagtacttcatcggaggcgttgagattactcaaccgg |
91 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||| ||| ||||| ||||||| ||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
38793190 |
taaccgtcacttccgattcgattcattcgaacattactaccggcggtgctccaaaagt-tttcatcggaggcgttgagattgctcaaccgg |
38793279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 63; Significance: 5e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 5e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 28731290 - 28731203
Alignment:
| Q |
1 |
taaccgtcacttccgagtcgattcatccgaacaanacttccggcagtgctccnaaagtacttcatcggaggcgttgagattactcaacc |
89 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||| ||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28731290 |
taactgtcacttccgagtcgattcatccgaacagcacttccggcggtgctccaaaagta-ttcatcggaggcgttgagattactcaacc |
28731203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 31529244 - 31529202
Alignment:
| Q |
1 |
taaccgtcacttccgagtcgattcatccgaacaanacttccgg |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31529244 |
taaccgtcacttccgagtcgattcatccgaacaacacttccgg |
31529202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 5 - 43
Target Start/End: Complemental strand, 51801308 - 51801270
Alignment:
| Q |
5 |
cgtcacttccgagtcgattcatccgaacaanacttccgg |
43 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
51801308 |
cgtcacttccgattcgattcatccgaacaacacttccgg |
51801270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 34875976 - 34876015
Alignment:
| Q |
1 |
taaccgtcacttccgagtcgattcatccgaacaanacttc |
40 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
34875976 |
taaccatcacttccgagtcgattcatccgaacaacacttc |
34876015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University