View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-80 (Length: 63)
Name: NF4336-Insertion-80
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-80 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 8e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 8e-20
Query Start/End: Original strand, 11 - 63
Target Start/End: Original strand, 12934961 - 12935013
Alignment:
| Q |
11 |
ggatatgttgacgaaagttgtagcacgtgaaaagcttcaactctgtgccgagt |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12934961 |
ggatatgttgacgaaagttgtagcacgtgaaaagcttcaactttgtgccgagt |
12935013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 3e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 3e-19
Query Start/End: Original strand, 12 - 63
Target Start/End: Original strand, 14178232 - 14178283
Alignment:
| Q |
12 |
gatatgttgacgaaagttgtagcacgtgaaaagcttcaactctgtgccgagt |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14178232 |
gatatgttgacgaaagttgtagcacgtgaaaagcttcaactttgtgccgagt |
14178283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 13 - 63
Target Start/End: Complemental strand, 28607640 - 28607590
Alignment:
| Q |
13 |
atatgttgacgaaagttgtagcacgtgaaaagcttcaactctgtgccgagt |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28607640 |
atatgttgacgaaagttgtagcacgtgaaaagcttcaactttgtgccgagt |
28607590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University