View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-88 (Length: 204)
Name: NF4336-Insertion-88
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-88 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 6 - 203
Target Start/End: Complemental strand, 42523928 - 42523723
Alignment:
| Q |
6 |
agggggtgggtctgagtttcacatggtagtgtggggtcaacagaatgaagtctgaatcatgttatgtaggctaataagaagtcatggtgacagtgtgaca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42523928 |
agggggtgggtctgagtttcacatggtagtgtggggtcaacagaatgaagtctgaatcatgttatgtaggctaataagaagtcatggtgacagtgtgaca |
42523829 |
T |
 |
| Q |
106 |
cgccaaatccacctcatcagattggaacccccatcttataatgtttagag---atgttggccatgagaacggctatt-----tacttgtactatggaata |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42523828 |
cgccaaatccacctcatcagattggaacccccatcttataatgtttagagatcatgttggccatgagaacggctattgtttatacttgtactatggaata |
42523729 |
T |
 |
| Q |
198 |
ttttgt |
203 |
Q |
| |
|
|||||| |
|
|
| T |
42523728 |
ttttgt |
42523723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University