View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336-Insertion-95 (Length: 91)
Name: NF4336-Insertion-95
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336-Insertion-95 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 5e-28; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 5e-28
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 9072217 - 9072131
Alignment:
| Q |
1 |
gattgcacaagatatttccccgaatacaaatataaagttgtcacattattttcacaagatagttcatacctgctgtctccgcagtgt |
87 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
9072217 |
gattgcacataatattttcccgaatacaaatataaagttgccacattattttcacaagatagttcgtacctgctttctccgcagtgt |
9072131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 8864062 - 8863980
Alignment:
| Q |
1 |
gattgcacaagatatttccccgaatacaaatataaagttgtcacattattttcacaagatagttcatacctgctgtctccgca |
83 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||| ||||||||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
8864062 |
gattgcacatgatattttcccgaatacaaatataaagttgtaacattatttgcacaagatagctcatacctgctgtccccgca |
8863980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 25 - 90
Target Start/End: Original strand, 9065617 - 9065682
Alignment:
| Q |
25 |
tacaaatataaagttgtcacattattttcacaagatagttcatacctgctgtctccgcagtgtatt |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
9065617 |
tacaaatataaagttgtcacattattttcacaagatagttcatacttgctgttaccgcagtgtatt |
9065682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 22 - 80
Target Start/End: Original strand, 8972335 - 8972393
Alignment:
| Q |
22 |
gaatacaaatataaagttgtcacattattttcacaagatagttcatacctgctgtctcc |
80 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8972335 |
gaatataaatataaagttgtgacattattttcacaagctagttcatacctgctgtctcc |
8972393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 12 - 83
Target Start/End: Complemental strand, 8868287 - 8868216
Alignment:
| Q |
12 |
atatttccccgaatacaaatataaagttgtcacattattttcacaagatagttcatacctgctgtctccgca |
83 |
Q |
| |
|
|||||| || |||||||||| ||| |||||||| ||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
8868287 |
atattttccggaatacaaatttaaggttgtcacgttattttcacaagatagttcatacctgctatccccgca |
8868216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 9007354 - 9007409
Alignment:
| Q |
1 |
gattgcacaagatatttccccgaatacaaatataaagttgtcacattattttcaca |
56 |
Q |
| |
|
||||||||| ||||||| || |||||||||| |||||||||||||||||||||||| |
|
|
| T |
9007354 |
gattgcacatgatattttcctgaatacaaatttaaagttgtcacattattttcaca |
9007409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 9099717 - 9099662
Alignment:
| Q |
28 |
aaatataaagttgtcacattattttcacaagatagttcatacctgctgtctccgca |
83 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
9099717 |
aaatataattttgtcacattattttcacaagctagttcgtacctgctgtctccgca |
9099662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.000000000007
Query Start/End: Original strand, 28 - 87
Target Start/End: Complemental strand, 9136397 - 9136338
Alignment:
| Q |
28 |
aaatataaagttgtcacattattttcacaagatagttcatacctgctgtctccgcagtgt |
87 |
Q |
| |
|
||||||||| |||| | |||||||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
9136397 |
aaatataaacttgttatattattttcacaagctagttcataactgctgtcaccgcagtgt |
9136338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University