View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336_high_37 (Length: 232)
Name: NF4336_high_37
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336_high_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 14 - 114
Target Start/End: Original strand, 39732369 - 39732469
Alignment:
| Q |
14 |
attatactggaatatggtggatgaaagatcagtcttcagtaccttttattggttcacaattggtaattattaaacaacacaaatcagacggtctgactga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39732369 |
attatactggaatatggtggatgaaagatcagtcttcagtaccttttattggttcacaattggtaattattaaacaacacaaatcagacggtctgactga |
39732468 |
T |
|
| Q |
114 |
t |
114 |
Q |
| |
|
| |
|
|
| T |
39732469 |
t |
39732469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 113 - 219
Target Start/End: Original strand, 39732498 - 39732610
Alignment:
| Q |
113 |
atatacaattcaatgcacttccaagtcggtgaagctttatgtcttataaaaacttgttacaccc-ttcctattttactat-----gaaaaatgctaaata |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
39732498 |
atatacaattcaatgcacttccaagtcggtgaagctttatgtcttataaaaacttgtcacaccctttcctattttactatgaaaagaaaaatgctaaata |
39732597 |
T |
|
| Q |
207 |
tcacgataaaact |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39732598 |
tcacgataaaact |
39732610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University