View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336_high_39 (Length: 226)
Name: NF4336_high_39
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336_high_39 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 34192715 - 34192492
Alignment:
| Q |
1 |
ttaactaagttactttgttatatgattatgctaaagttaaactatcttaataaaggttgaaaagaacactataatgnnnnnnnaatataagctagaaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
34192715 |
ttaactaagttactttgttatatgattatgctaaagttaaactatcttaataaaggttgaaaagaacacta--atgattttt-aatataagctagaaata |
34192619 |
T |
 |
| Q |
101 |
gattttnnnnnnnnnnnnnnnnn-gaacaagaattttagggacataaacctagatatgtttaatcgagataaattttgaaactgtttgagtaatttatat |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34192618 |
gattttcaaaaaaagaagaaaaaagaacaagaattttagggacataaacctagatatgtttaatcgagataaattttgaaactgcttgagtaatttatat |
34192519 |
T |
 |
| Q |
200 |
gtatttttatcaacgttgtgagtcttg |
226 |
Q |
| |
|
|||||||||||||||| ||||||||| |
|
|
| T |
34192518 |
atatttttatcaacgttatgagtcttg |
34192492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University