View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336_high_40 (Length: 207)
Name: NF4336_high_40
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 25 - 188
Target Start/End: Original strand, 3052084 - 3052247
Alignment:
| Q |
25 |
gacaaaattttaagaaacagttaaaacaacatatatccgtaaaagggacaaaccggaaaccaatgcgccgtgagccatcttgccttcttgctgccactcc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3052084 |
gacaaaattttaagaaacagttaaaacaacatatatccgtaaaagggacaaaccggaaaccaatgcgccgtgagccatcttgccttcttgctgccactcc |
3052183 |
T |
 |
| Q |
125 |
tgctgcctctggatgtcgccgttccaacgctgccaacagccgtccatcccctacaccactggct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3052184 |
tgctgcctctggatgtcgccgttccaacgctgccaacagccgtccatcccctacaccactggct |
3052247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University