View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336_low_15 (Length: 382)
Name: NF4336_low_15
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 2486662 - 2486401
Alignment:
| Q |
1 |
cctctgcatgctttaaatggacataagcagcacttgtaagcaacacgcgtgtctgctcactgtcatgataaatacaatgagaaagatcttatcagaacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2486662 |
cctctgcatgctttaaatggacataagcagcacttgtaagcaacacgcgtgtctgctcactgtcatgataaatacaatgagaaagatcttatcagaacca |
2486563 |
T |
|
| Q |
101 |
atattgaatcgtgttaataaaatcaattagagattaaacattatgatttgctagttgtcattattatttgctagatcaaaatacagacactgtaggcgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2486562 |
atattgaatcgtgttaataaaatcaattagagatcaaacattatgatttgctagtcgtcattattatttgctagatcaaaatacagacacggtaggcgac |
2486463 |
T |
|
| Q |
201 |
accatatgtgtttatttatctccatctttttcttacattttatctttacaagtctacacattt |
263 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2486462 |
acca-atgtgtttatttatctccatctttttcttacattttatccttacaagtctacacattt |
2486401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 324 - 382
Target Start/End: Complemental strand, 2486340 - 2486282
Alignment:
| Q |
324 |
tatatggtttcctttatacgaataataatatgaatacaaatgtatgtcatacagcaacc |
382 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2486340 |
tatatggtttgctttatacgaataataatatgaatacaaatgtatgtcatacagcaacc |
2486282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 6 - 63
Target Start/End: Original strand, 41594898 - 41594955
Alignment:
| Q |
6 |
gcatgctttaaatggacataagcagcacttgtaagcaacacgcgtgtctgctcactgt |
63 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| || || ||||||||||||| |
|
|
| T |
41594898 |
gcatgctttaaatgaacatatgcagcacttgtaagcaaaacccgcgtctgctcactgt |
41594955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University