View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336_low_22 (Length: 339)
Name: NF4336_low_22
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 19 - 327
Target Start/End: Complemental strand, 28791130 - 28790822
Alignment:
| Q |
19 |
aacaggaacatatattggagatgaaatggtgatccatttcacaactggatcaggacaacaagcaactggaataccagctattttggaccgtttctttaca |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28791130 |
aacaggaatatatattggagatgaaatggtgatccatttcacaattggatcaggacaacaagcaactggaataccagctattttggaccgtttctttaca |
28791031 |
T |
 |
| Q |
119 |
agttcagctccctcttttgataccaaacttccatgccaaagatgccatgaagctgcagaaacaaggaatcatggtgtgttctcatcctgcttagattgct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28791030 |
agttcagctccctcttttgataccaaacttccatgccaaagatgccgtgaagctgcagaaacaaggaatcatggtgtgttctcatcctgcttagattgct |
28790931 |
T |
 |
| Q |
219 |
ttctttcaggaggtcaactctacctttttcagtatggtgtatccaaactacaatttttagcccaagctagaggaggtacatgcaccctagcttcttcgga |
318 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28790930 |
ttctttcagggggtcaactctacctttttcagtatggtgtatccaaactacagtttttagcccaagctagaggaggtacatgcaccctagcttcttcgga |
28790831 |
T |
 |
| Q |
319 |
tccaactga |
327 |
Q |
| |
|
||||||||| |
|
|
| T |
28790830 |
tccaactga |
28790822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University