View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336_low_25 (Length: 306)
Name: NF4336_low_25
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 7 - 290
Target Start/End: Original strand, 36570611 - 36570894
Alignment:
| Q |
7 |
aagaaaatcgaaatgaatggatgaatgaattagtttagtacctttctttgctttgccaccaccgggtttgggaggagccatggcagtgattttaaagcgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36570611 |
aagaaaatcgaaatgaatggatgaatgaattagtttagtacctttctttgctttgccaccaccgggtttgggaggagccatggcagtgattttaaagcgt |
36570710 |
T |
|
| Q |
107 |
ctttgagtggtgggaagtgaaaggggggttttgttttgaagggagacgccgctgggttttaaggataatttaagaggagtagaaaacatagtagaagagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36570711 |
ctttgagtggtgggaagtgaaaggggggttttgttttgaagggagacgccgctgggttttaaggataatttaagaggagtagaaaacatagtagaagagg |
36570810 |
T |
|
| Q |
207 |
aagaagaacatagcgacggagtgcagaagagtgtgaacgccattcaattgagttgttcggataaagtatccgcgctatcctaaa |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36570811 |
aagaagaacatagcgacggagtgcagaagagtgtggacgccattcaattgagttgttcggataaagtatccgcgctatcctaaa |
36570894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University