View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336_low_34 (Length: 249)
Name: NF4336_low_34
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 1238506 - 1238747
Alignment:
| Q |
1 |
ttcttcgttaagaaggaagaccatctatcaagaaagaagtatgacataaaaaatgtccgtctctttgtaaaataaacaagattaaacttctttttatttg |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1238506 |
ttctttgttaagaaggaagaccatctatcaagaaagaagtatgacataaaaaatgtccgtctctttgtaaaataaacaagattaaacttctttttatttg |
1238605 |
T |
 |
| Q |
101 |
ttcacacttctctttataccaagtaaaaggtgaatgggctcttccaacattcaacttttat-nnnnnnnnttagagtagtaataattctctaagaaacct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1238606 |
ttcacacttctctttataccaagtaaaaggtgaatgggctcttccaacattcaacttttataaaaaaaaattagagtagtaataattctctaagaaacct |
1238705 |
T |
 |
| Q |
200 |
ttagtttactaaacttcatacaaatttcagacaaagtataat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1238706 |
ttagtttactaaacttcatacaaatttcagacaaagtataat |
1238747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University