View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336_low_38 (Length: 239)
Name: NF4336_low_38
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 5040524 - 5040294
Alignment:
| Q |
1 |
tcctcattcacagggttgacatgattattatcatgaattcatgatgatctctaatcatttcattgttatcaaagacaatgattaatgtatctgatcttta |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5040524 |
tcctcattcacagggttgacatgaatattatcatgaattcatgatgatctctaatcatttcattattatcaaagacaatgattaatgtatctgatcttta |
5040425 |
T |
 |
| Q |
101 |
ttaattttctagccaaagttgcaggaaatatctaattgttaatgttttgattatcatannnnnnnngtaactttcttcggttaataattatcagtgactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5040424 |
ttaattttctagccaaagttgcaggaaatatctaattgttaatg-tttgattatcatattttttttgtaactttcttcggttaataattatcagtgactt |
5040326 |
T |
 |
| Q |
201 |
gacttgtttaaaattttccttaatgatgatgt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5040325 |
gacttgtttaaaattttccttaatgatgatgt |
5040294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University