View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336_low_41 (Length: 237)
Name: NF4336_low_41
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 8093418 - 8093253
Alignment:
| Q |
1 |
atatatgaacaaaccattttcggttatgtaaataattggatcattaaacttcttcttggtgtattctaataaatcttgaatccctggaggataaatgtaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8093418 |
atatatgaacaaaccattttcggttatgtaaataattggatcattaaacttctccttggtgtattctaataaatcttgaatccctggaggataaatgtag |
8093319 |
T |
|
| Q |
101 |
agccaatctgaggcaccctgcaaaattatccacttctcagtttctttttcaaatctaaattataat |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8093318 |
agccaatctgaggcaccctgcaaaattatccacttctcagtttctttttcaaatcaaaattataat |
8093253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University