View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4336_low_44 (Length: 229)
Name: NF4336_low_44
Description: NF4336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4336_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 24718119 - 24717917
Alignment:
| Q |
13 |
tgagatgaatgctaggagatttcagaacaaccactcatctattcaaaacctcataagtcatattcttgttgagattaagcttagcagttctcgagtgaag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24718119 |
tgagatgaatgctaggagatttcagaacaaccactcatctattcaaaacctcataagtcatattcttgttgagattaagcttagcagttctcgagtgaag |
24718020 |
T |
 |
| Q |
113 |
gaaaatggtacttcttctaagatggacttctatgttactaggttccttggtgtctcttacaaacatgtcaggttgtcggagaaaattgaagttaggtgga |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24718019 |
gaaaatggtaattcttctaagatggacttctatgttactaggttccttggcgtctcttacaaacatgtcaggttgttggagaaaattgaagttaggtgga |
24717920 |
T |
 |
| Q |
213 |
ttc |
215 |
Q |
| |
|
||| |
|
|
| T |
24717919 |
ttc |
24717917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University