View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4337-Insertion-2 (Length: 52)
Name: NF4337-Insertion-2
Description: NF4337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4337-Insertion-2 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 32; Significance: 0.0000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.0000000008
Query Start/End: Original strand, 13 - 52
Target Start/End: Original strand, 7843392 - 7843430
Alignment:
| Q |
13 |
ccgcgtacaattgtgaagactgatttttctaaaacatata |
52 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7843392 |
ccgcgtacaattgtgaagactgatttttc-aaaacatata |
7843430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University