View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4337-Insertion-4 (Length: 110)
Name: NF4337-Insertion-4
Description: NF4337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4337-Insertion-4 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 2e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 2e-55
Query Start/End: Original strand, 2 - 110
Target Start/End: Original strand, 16610702 - 16610810
Alignment:
| Q |
2 |
aaaatggcgataaataatgcattgtagacggtgtgagaacgtgactttgattgaagtaattattatagttatggaatattgcttatacacgtacggtaaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16610702 |
aaaatggcgataaataatgcattgtagacggtgtgagaacgtgactttgattgaagtaattattatagttatggaatattgcttatacacgtacggtaaa |
16610801 |
T |
|
| Q |
102 |
attcaaact |
110 |
Q |
| |
|
||||||||| |
|
|
| T |
16610802 |
attcaaact |
16610810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University