View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4337_high_1_N (Length: 356)
Name: NF4337_high_1_N
Description: NF4337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4337_high_1_N |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 30 - 145
Target Start/End: Complemental strand, 34856818 - 34856703
Alignment:
| Q |
30 |
gggattagcattccagttataaattatcctacaagtttctgattgggaatctggcacggtggagtattttttgattgtaatactgcattctatattgttc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34856818 |
gggattagcattccagttataaattatcctacaagtttctgattgggaatctggcacggtggagtatttattgattgtaatactgcattctatattgttc |
34856719 |
T |
|
| Q |
130 |
atcattgtagccactg |
145 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34856718 |
atcattgtagccactg |
34856703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 199 - 327
Target Start/End: Original strand, 52770471 - 52770602
Alignment:
| Q |
199 |
agtcagtgaattactaagttgctagtaaagtttccaatacttaaatagagagaatttttattgaaaataaattttctagttttgagctaagtt---ttct |
295 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52770471 |
agtcagtgaattacaaagttgctagtaaagtttccaatactaaaatagagagaattttgattgaaaataaattttctagttttgagctaagttttcttct |
52770570 |
T |
|
| Q |
296 |
atcttattcttgacatttactcagttttagta |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52770571 |
atcttattcttgacatttactcagttttagta |
52770602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University