View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4338-Insertion-1 (Length: 109)
Name: NF4338-Insertion-1
Description: NF4338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4338-Insertion-1 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 5e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 5e-47
Query Start/End: Original strand, 7 - 109
Target Start/End: Complemental strand, 3674234 - 3674133
Alignment:
| Q |
7 |
agtggttctattagaattgctcacaggaagaagggtagtggataagtcttcagaatcaagtagagggaaaaacttaggtggaatgggcaagaccaatgtt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3674234 |
agtggttctattagaattgctcacaggaagaagggtagtggataagtcttcagaatcaagtagagggaaaaactt-ggtggaatgggcaagaccaatgtt |
3674136 |
T |
|
| Q |
107 |
gag |
109 |
Q |
| |
|
||| |
|
|
| T |
3674135 |
gag |
3674133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University