View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4338-Insertion-10 (Length: 116)
Name: NF4338-Insertion-10
Description: NF4338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4338-Insertion-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 6e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 6e-53
Query Start/End: Original strand, 12 - 116
Target Start/End: Original strand, 6361290 - 6361394
Alignment:
| Q |
12 |
atggaaacaatgaagtgtatagttcattcatgcaatcgttgatgtttcaactgtgaattgaattaatgaatctaaagacctggtattttgttattttgtc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6361290 |
atggaaacaatgaagtgtatagttcattcatgcaatcgttgatgtttcaactgtgaattgaattaatgaatctaaagacctggtattttgttattttgtc |
6361389 |
T |
|
| Q |
112 |
ctctg |
116 |
Q |
| |
|
||||| |
|
|
| T |
6361390 |
ctctg |
6361394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University