View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4338-Insertion-11 (Length: 118)
Name: NF4338-Insertion-11
Description: NF4338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4338-Insertion-11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 5 - 108
Target Start/End: Original strand, 53306677 - 53306780
Alignment:
| Q |
5 |
actcatacctttataaacagaaacaaatggatgaaggtgtatgtaattgggaacagttccaacttgtttattctgctagccgtgattattaaatgattgt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53306677 |
actcatacctttataaacagaaacaaatggatgaaggtgtatgtaattgggaacagttccaacttgtttattctgctagccgtgattattaaatgattgt |
53306776 |
T |
 |
| Q |
105 |
tttt |
108 |
Q |
| |
|
|||| |
|
|
| T |
53306777 |
tttt |
53306780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University