View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4338-Insertion-6 (Length: 183)
Name: NF4338-Insertion-6
Description: NF4338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4338-Insertion-6 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 7e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 7e-94
Query Start/End: Original strand, 6 - 183
Target Start/End: Original strand, 23128059 - 23128236
Alignment:
| Q |
6 |
gcaactaacgtctaactctttctgaacaactctgggcctcttggtgggccttttccgaggccgacaacctgtcaacaccatgaaatcttcatcgatttgc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23128059 |
gcaactaacgtctaactctttctgaacaactctgggcctcttggtgggccttttccgaggccgacaacctgtcaacaccatgaaatcttcatcgatttcc |
23128158 |
T |
|
| Q |
106 |
ttcctcaagagctgaagagaaaatttcggtgtttcaacctcgttactaggaatattacttctcaaccttgacgaaata |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23128159 |
ttcctcaagagctgaagagaaaatttcggtgtttcaacctcgttactaggaatattacttctcaaccttgacgaaata |
23128236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 36 - 132
Target Start/End: Original strand, 23096371 - 23096467
Alignment:
| Q |
36 |
tctgggcctcttggtgggccttttccgaggccgacaacctgtcaacaccatgaaatcttcatcgatttgcttcctcaagagctgaagagaaaatttc |
132 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || || | ||| ||| ||||||||| ||||||| |||| | || ||||||| |||||||||| |
|
|
| T |
23096371 |
tctgggcctcttagtgggccttttccgaggcccacggcccataaacgccacgaaatcttcctcgatttccttcgttaaaagctgaacagaaaatttc |
23096467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University