View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4338-Insertion-7 (Length: 51)
Name: NF4338-Insertion-7
Description: NF4338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4338-Insertion-7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 42; Significance: 9e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 9e-16
Query Start/End: Original strand, 6 - 51
Target Start/End: Original strand, 4536707 - 4536752
Alignment:
| Q |
6 |
gttaccccaattgaattgccctcacttatgcataggcattattgtg |
51 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4536707 |
gttaccccaattgaattgccctcacttatccataggcattattgtg |
4536752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University