View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4339_high_2 (Length: 493)
Name: NF4339_high_2
Description: NF4339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4339_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 4e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 263 - 455
Target Start/End: Original strand, 5417793 - 5417980
Alignment:
| Q |
263 |
gatttaaggttcttaaaaagtccctcaaggacacactcaaacaccaaaactctcctcctttcaccctcatcgggtctacgtattattaattaaagagcta |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5417793 |
gatttaaggttcttaaaaagtccctcaaggacacactcaaacaccaaaactctcctcctttcaccctcatcgggtctacg---tattaattaaagagcta |
5417889 |
T |
|
| Q |
363 |
aacaatgacctttgcttctcctctatgatattattaccctccaaaattatttagtacataaaaatagttaagccaatgttgccttaaacttca |
455 |
Q |
| |
|
||||||||||||||| | | |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5417890 |
aacaatgacctttgccatacgacaatgatattat--ccctccaaaattatttagtacataaaaatagttaagccaatgttgccttaaacttca |
5417980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 121; E-Value: 9e-62
Query Start/End: Original strand, 13 - 190
Target Start/End: Original strand, 5417537 - 5417719
Alignment:
| Q |
13 |
taatatatgttgcccttattttactctgatgatctttaccgtcaaacttttcgtctcatacaacattgtcgattttagagtagtacgataannnnnnnct |
112 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5417537 |
taatatatgttgcccttattttactctcatgatctttaccgtcaaacttttcgtctcatacaacattgtcgattttagagtagtacgataatttttttct |
5417636 |
T |
|
| Q |
113 |
tcaatttgaacagtacttttgtactccatatcaattagga-tttgc----ttacgagtacccgaaacattttttaaggattct |
190 |
Q |
| |
|
| ||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
5417637 |
ttaatttgaacggtacttttgtactccatatcaattaggattttgcttaattacgagtacccgaaacactttttaaggattct |
5417719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University