View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4340-Insertion-10 (Length: 87)
Name: NF4340-Insertion-10
Description: NF4340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4340-Insertion-10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 5e-28; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 5e-28
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 45352156 - 45352078
Alignment:
| Q |
1 |
gatatttgatatgttaatatctactatgtaaccttgcaaagggatgtttgcgttgcagtttgtattggtttggaagtaa |
79 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
45352156 |
gatattggatatgttaatatctactatgtaaccttgtaaagggatgtttgcgttgcggtttatattggtttggaagtaa |
45352078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 5e-28
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 45361635 - 45361557
Alignment:
| Q |
1 |
gatatttgatatgttaatatctactatgtaaccttgcaaagggatgtttgcgttgcagtttgtattggtttggaagtaa |
79 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
45361635 |
gatattggatatgttaatatctactatgtaaccttgtaaagggatgtttgcgttgcggtttatattggtttggaagtaa |
45361557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 45367305 - 45367266
Alignment:
| Q |
1 |
gatatttgatatgttaatatctactatgtaaccttgcaaa |
40 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
45367305 |
gatatttgatatgttaatatctattatgtaatctcgcaaa |
45367266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University