View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4340-Insertion-10 (Length: 87)

Name: NF4340-Insertion-10
Description: NF4340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4340-Insertion-10
NF4340-Insertion-10
[»] chr4 (3 HSPs)
chr4 (1-79)||(45352078-45352156)
chr4 (1-79)||(45361557-45361635)
chr4 (1-40)||(45367266-45367305)


Alignment Details
Target: chr4 (Bit Score: 63; Significance: 5e-28; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 63; E-Value: 5e-28
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 45352156 - 45352078
Alignment:
1 gatatttgatatgttaatatctactatgtaaccttgcaaagggatgtttgcgttgcagtttgtattggtttggaagtaa 79  Q
    |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||||    
45352156 gatattggatatgttaatatctactatgtaaccttgtaaagggatgtttgcgttgcggtttatattggtttggaagtaa 45352078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 63; E-Value: 5e-28
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 45361635 - 45361557
Alignment:
1 gatatttgatatgttaatatctactatgtaaccttgcaaagggatgtttgcgttgcagtttgtattggtttggaagtaa 79  Q
    |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||||    
45361635 gatattggatatgttaatatctactatgtaaccttgtaaagggatgtttgcgttgcggtttatattggtttggaagtaa 45361557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 45367305 - 45367266
Alignment:
1 gatatttgatatgttaatatctactatgtaaccttgcaaa 40  Q
    ||||||||||||||||||||||| ||||||| || |||||    
45367305 gatatttgatatgttaatatctattatgtaatctcgcaaa 45367266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University