View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4340-Insertion-5 (Length: 117)
Name: NF4340-Insertion-5
Description: NF4340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4340-Insertion-5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 9721565 - 9721449
Alignment:
| Q |
1 |
ccctccaccaatgcattattcaccagagagaacaggaacaaaaactccaccacttcatatcacagcatcaataccatttggttgggaagaagagccagga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9721565 |
ccctccaccaatgcattattcaccagagagatcaggaacaaaaactccaccacttcatatcacagcgtcaataccatttggttgggaagaagagccagga |
9721466 |
T |
|
| Q |
101 |
aaaccaagaccatgtac |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9721465 |
aaaccaagaccatgtac |
9721449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University