View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4340_high_1 (Length: 435)
Name: NF4340_high_1
Description: NF4340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4340_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 206 - 429
Target Start/End: Complemental strand, 12597059 - 12596837
Alignment:
| Q |
206 |
ctgttttgatgtgcagggaacaactgttagggttgaatttggtgatggaacaacaactgctgatccagctgatgagcctactataagtagatctttccct |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12597059 |
ctgttttgatgtgcagggaacaactgttagggttgaatttggtgatggaacaacaactgctgatccagctgatgagcctactataagtagatctttcc-t |
12596961 |
T |
 |
| Q |
306 |
aatacctatggacaccctttggctcattttcttagggctactgctaaagttcctgatgctcagatcataactgaacaccctcctattaggttagttaatc |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12596960 |
aatacctatggacaccctttggctcattttcttagggctacagctaaagttcctgatgctcagatcataacagaacaccctcctattaggttagttaatc |
12596861 |
T |
 |
| Q |
406 |
tattttgttttgatttgatgatgt |
429 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
12596860 |
tattttgttttgatttgttgatgt |
12596837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 13 - 46
Target Start/End: Complemental strand, 12597253 - 12597220
Alignment:
| Q |
13 |
tgagatgggtggtgatgaatttgaatgtaatggt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12597253 |
tgagatgggtggtgatgaatttgaatgtaatggt |
12597220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University