View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4341-Insertion-5 (Length: 103)
Name: NF4341-Insertion-5
Description: NF4341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4341-Insertion-5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 9e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 9e-52
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 34798381 - 34798279
Alignment:
| Q |
1 |
acaacatcaatgaaccaaaaaaccaagacaaatcaaacttgaagcttttgttctttgatttaatctactaccaaacattgtaatttcgcttgcacccatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34798381 |
acaacatcaatgaaccaaaaaaccaagacaaatcaaacttgaagcttttgttctttgatttaatctactaccaaacattgtaatttcgcttgcacccatt |
34798282 |
T |
 |
| Q |
101 |
att |
103 |
Q |
| |
|
||| |
|
|
| T |
34798281 |
att |
34798279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University