View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4341-Insertion-6 (Length: 193)
Name: NF4341-Insertion-6
Description: NF4341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4341-Insertion-6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 7e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 6 - 164
Target Start/End: Complemental strand, 38841315 - 38841157
Alignment:
| Q |
6 |
gttctttggtcaccttaactatgattataatgtgaagaaaactactggtgggagaaatggttatggtgctaagctcaccaatattttttcgaaggagttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38841315 |
gttctttggtcaccttaactatgattataatgtgaagaaaactactggtgggagaaatggttatggtgctaagctcaccaatattttttcgaaggagttt |
38841216 |
T |
|
| Q |
106 |
gttattgagattgttgatggacgtcgtttgaagaagtataagcaggtagtgatttgttg |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38841215 |
gttattgagattgttgatggacgtcgtttgaagaagtataagcaggtagtgatttgttg |
38841157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 9e-38
Query Start/End: Original strand, 32 - 159
Target Start/End: Complemental strand, 9877358 - 9877231
Alignment:
| Q |
32 |
ataatgtgaagaaaactactggtgggagaaatggttatggtgctaagctcaccaatattttttcgaaggagtttgttattgagattgttgatggacgtcg |
131 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||| |||| |||||||||||||| | || ||||||||| | |
|
|
| T |
9877358 |
ataatgtgaagaaaactactggtggaagaaacggttatggtgctaagctcacgaatattttctcgactgagtttgttattgaaactgctgatggacggag |
9877259 |
T |
|
| Q |
132 |
tttgaagaagtataagcaggtagtgatt |
159 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
9877258 |
gttgaagaagtataagcaggtagtgatt |
9877231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University