View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4341-Insertion-7 (Length: 134)

Name: NF4341-Insertion-7
Description: NF4341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4341-Insertion-7
NF4341-Insertion-7
[»] scaffold0182 (1 HSPs)
scaffold0182 (5-101)||(25627-25723)
[»] chr7 (19 HSPs)
chr7 (8-100)||(21785663-21785755)
chr7 (9-110)||(21714441-21714542)
chr7 (7-100)||(21652325-21652418)
chr7 (9-98)||(21726154-21726243)
chr7 (9-98)||(21772219-21772308)
chr7 (7-131)||(21788485-21788609)
chr7 (6-92)||(21623448-21623534)
chr7 (8-94)||(21807970-21808056)
chr7 (6-131)||(21992437-21992562)
chr7 (7-92)||(21664357-21664442)
chr7 (7-96)||(21792267-21792356)
chr7 (8-96)||(21681907-21681995)
chr7 (18-97)||(21628392-21628471)
chr7 (6-97)||(21764317-21764408)
chr7 (22-92)||(15713894-15713964)
chr7 (18-103)||(21689680-21689765)
chr7 (29-92)||(21745810-21745873)
chr7 (7-100)||(21646999-21647096)
chr7 (29-92)||(21704921-21704984)
[»] chr1 (1 HSPs)
chr1 (34-78)||(18192060-18192104)
[»] chr8 (1 HSPs)
chr8 (49-84)||(14060595-14060630)


Alignment Details
Target: scaffold0182 (Bit Score: 81; Significance: 2e-38; HSPs: 1)
Name: scaffold0182
Description:

Target: scaffold0182; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 5 - 101
Target Start/End: Original strand, 25627 - 25723
Alignment:
Q  5 aaaagtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaagccag 101  Q
    |||||||||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  25627 aaaagtctcttgaaggctttggtacccttgaagaaaagctgtcgttgatgttgttcgtggatggatgttctttgctacatatcttggagaatgccag 25723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 81; Significance: 2e-38; HSPs: 19)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 21785663 - 21785755
Alignment:
Q  8 agtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaagcca 100  Q
    ||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  21785663 agtctcttgaagactttggtagccttgaagaaaagctgtcgtggatgttgtttgtggatggatgttctttgctacatatcttggagaaagcca 21785755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 78; E-Value: 1e-36
Query Start/End: Original strand, 9 - 110
Target Start/End: Original strand, 21714441 - 21714542
Alignment:
Q  9 gtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaagccaggcgtgat 108  Q
    |||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| || ||||    
T  21714441 gtctcttgaaggctttggtagccttgaagaaaagctatcgtggatgttgttcgtggatggatgttctttgcttcatatcttggagagagccaagcttgat 21714540  T
Q  109 ga 110  Q
    ||    
T  21714541 ga 21714542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 21652325 - 21652418
Alignment:
Q  7 aagtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaagcca 100  Q
    |||||||||| |||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||    
T  21652325 aagtctcttgaaggctttgatagccttgaagaaaagttgtcgtggatgttgttcgtggatggatgttcgttgctgcatatcttggagaaagcca 21652418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 9 - 98
Target Start/End: Original strand, 21726154 - 21726243
Alignment:
Q  9 gtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaagc 98  Q
    |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||    
T  21726154 gtctcttgcaggctttcgtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctgtatatcttggagaaagc 21726243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 70; E-Value: 6e-32
Query Start/End: Original strand, 9 - 98
Target Start/End: Original strand, 21772219 - 21772308
Alignment:
Q  9 gtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaagc 98  Q
    |||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||  ||||||||||||||||    
T  21772219 gtctcttgcaggctttcgtagccttgaagaaaagttgtcgtggatgttgttcgtggatggatgttctttgctgtatatcttggagaaagc 21772308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 7 - 131
Target Start/End: Original strand, 21788485 - 21788609
Alignment:
Q  7 aagtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaagccaggcgtg 106  Q
    |||||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |  ||||||| |||||||||| || ||    
T  21788485 aagtctcttgaaggctttggaagcctcgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgttgtatatcttagagaaagccaagcttg 21788584  T
Q  107 atgaccaagttcacatgaatattaa 131  Q
    |||| |  |  ||||||||||||||    
T  21788585 atgaacctgggcacatgaatattaa 21788609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 67; E-Value: 4e-30
Query Start/End: Original strand, 6 - 92
Target Start/End: Original strand, 21623448 - 21623534
Alignment:
Q  6 aaagtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttgga 92  Q
    ||||||||||| ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||    
T  21623448 aaagtctcttgaaggctttggtagcattaaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctgcatatcatgga 21623534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 67; E-Value: 4e-30
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 21808056 - 21807970
Alignment:
Q  8 agtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggaga 94  Q
    ||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||  ||||||||||||    
T  21808056 agtctcttgaaggctttggtagccttgaagaaaagctgtcatggatgttgttcgtggatggatgctctttgctttatatcttggaga 21807970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 66; E-Value: 1e-29
Query Start/End: Original strand, 6 - 131
Target Start/End: Original strand, 21992437 - 21992562
Alignment:
Q  6 aaagtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaagccaggcgt 105  Q
    ||||||||||| ||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||| |  ||||||| |||||||||| || |    
T  21992437 aaagtctcttgaaggctttggaagcctcgaagaaaagctgtcatggatgttgttcgtggatggatgttctttgttgtatatcttagagaaagccaagctt 21992536  T
Q  106 gatgaccaagttcacatgaatattaa 131  Q
    ||||| |  |  ||||||||||||||    
T  21992537 gatgaacctgggcacatgaatattaa 21992562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 62; E-Value: 3e-27
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 21664357 - 21664442
Alignment:
Q  7 aagtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttgga 92  Q
    |||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||  ||||||||||    
T  21664357 aagtctcttgaaggctttggaagccttgaagaaaagctgtcgtggatattgttcgtggatggatgctctttgctttatatcttgga 21664442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 62; E-Value: 3e-27
Query Start/End: Original strand, 7 - 96
Target Start/End: Original strand, 21792267 - 21792356
Alignment:
Q  7 aagtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaa 96  Q
    ||||||||||  |||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||| | |||||||||||||||    
T  21792267 aagtctcttgacggctttggtagcctcgaagaaaagctgtcatggatattgttcgtggatggatgttctttgttgcatatcttggagaaa 21792356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 61; E-Value: 1e-26
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 21681907 - 21681995
Alignment:
Q  8 agtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaa 96  Q
    ||||||||| ||||| |  |||||||||||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||    
T  21681907 agtctcttgaaggctatcatagccttgaagaaaagttatcatggatgttgttcgtggatggatgttctttgctacatatcttggagaaa 21681995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 21628392 - 21628471
Alignment:
Q  18 aggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaag 97  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||||||||| ||||||||  |||||||||||||||    
T  21628392 aggctttggatgccttgaagaaaagctgtcgtggatgttgttcgtggatggatgctctttgctttatatcttggagaaag 21628471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 6 - 97
Target Start/End: Original strand, 21764317 - 21764408
Alignment:
Q  6 aaagtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaag 97  Q
    ||||||||||| |||||||  |||||||||||||||| |||||||||||||||||||||||||||| ||||||||  || ||||||||||||    
T  21764317 aaagtctcttgaaggctttcatagccttgaagaaaagttgtcgtggatgttgttcgtggatggatgctctttgctttatctcttggagaaag 21764408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 55; E-Value: 5e-23
Query Start/End: Original strand, 22 - 92
Target Start/End: Original strand, 15713894 - 15713964
Alignment:
Q  22 tttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttgga 92  Q
    ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||    
T  15713894 tttggtagcctagaagaaaagctgtcatggatgttgttcgtggatggatgctctttgctgcatatcttgga 15713964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 18 - 103
Target Start/End: Original strand, 21689680 - 21689765
Alignment:
Q  18 aggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttggagaaagccaggc 103  Q
    |||||||| ||| |||||||||||||| |||||||||||||| ||||||||||| ||||||||  ||||||||||||||| |||||    
T  21689680 aggctttgatagtcttgaagaaaagctatcgtggatgttgttggtggatggatgctctttgctttatatcttggagaaagacaggc 21689765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 29 - 92
Target Start/End: Original strand, 21745810 - 21745873
Alignment:
Q  29 gccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttgga 92  Q
    |||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||    
T  21745810 gccttgaagaaaagctgtcgtggatgttattcgtagatggatgttctttgctccatatcttgga 21745873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 21646999 - 21647096
Alignment:
Q  7 aagtctcttggaggctttggtagccttgaagaaaagctgtcgtggatgttgttcgtgg----atggatgttctttgctacatatcttggagaaagcca 100  Q
    |||||||||  ||||||  ||||||||||||||||| |||||||||| ||||||||||    |||||||||||||||| |||||||| ||||||||||    
T  21646999 aagtctcttaaaggcttccgtagccttgaagaaaagttgtcgtggatattgttcgtggatatatggatgttctttgctgcatatcttagagaaagcca 21647096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 29 - 92
Target Start/End: Original strand, 21704921 - 21704984
Alignment:
Q  29 gccttgaagaaaagctgtcgtggatgttgttcgtggatggatgttctttgctacatatcttgga 92  Q
    ||||||| ||||||||||||||||| |||||| ||||||||||||||||||| |||||||||||    
T  21704921 gccttgatgaaaagctgtcgtggatattgttcatggatggatgttctttgctccatatcttgga 21704984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.0000000007; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 34 - 78
Target Start/End: Complemental strand, 18192104 - 18192060
Alignment:
Q  34 gaagaaaagctgtcgtggatgttgttcgtggatggatgttctttg 78  Q
    ||||||||||| || ||||||||||| ||||||||||||||||||    
T  18192104 gaagaaaagctatcatggatgttgtttgtggatggatgttctttg 18192060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 28; Significance: 0.0000007; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 49 - 84
Target Start/End: Complemental strand, 14060630 - 14060595
Alignment:
Q  49 tggatgttgttcgtggatggatgttctttgctacat 84  Q
    ||||| |||||||||||||||||||| |||||||||    
T  14060630 tggatattgttcgtggatggatgttccttgctacat 14060595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University