View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4341_high_1 (Length: 324)
Name: NF4341_high_1
Description: NF4341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4341_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 41 - 312
Target Start/End: Original strand, 43389041 - 43389312
Alignment:
| Q |
41 |
gaaatcaagttttcttctttgctaataaaatacaaactagagaatctcgactgcagatgtaatatggattcacaaatatccaacgcccggaccccattta |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43389041 |
gaaatcaagttttcttctttgctaataaaatacaaactagagaatctcgactgcagatgtaatatggattcacaaatatccaacgcccggaccccattta |
43389140 |
T |
|
| Q |
141 |
atattttatacattatgggaaaactaaaaagctaattcatattaaaatgttattcatagttttttaggacttaagtctagtttcatcaaggttgaatcct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43389141 |
atattttatacattatgggaaaactaaaaagctaattcatattaaaatgttattcatagttttttaggacttaagtctagtttcatcaaggttgaatcct |
43389240 |
T |
|
| Q |
241 |
acaacattcattcattctttttacctttttctctatggctctcttgatttattttgttttctctcacatatt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43389241 |
acaacattcattcattctttttacctttttctctatggctctcttgatttattttgttttctctcacatatt |
43389312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University