View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4341_low_2 (Length: 203)
Name: NF4341_low_2
Description: NF4341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4341_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 29 - 189
Target Start/End: Complemental strand, 31829586 - 31829426
Alignment:
| Q |
29 |
aacttgcctgagcatacaaatgctcgtcaaacatacgaacagcacaaggccctgacgtggaagccgcctgtctaggttgttagatcataacctggtctag |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31829586 |
aacttgcctgagcatacaaatgctcgtcaaacatacgaacagcacaaggccctgacgtggaagctgcctgtctaggttgttagatcataacctggtctag |
31829487 |
T |
 |
| Q |
129 |
gggcttcaaagcttcaaatcacatgatactctacacggttctcctttgggttaatctctgc |
189 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31829486 |
gggcttcaatgcttcaaatcacatgatactctacacggttctcctttgggttaatctctgc |
31829426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University