View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4342-Insertion-11 (Length: 176)
Name: NF4342-Insertion-11
Description: NF4342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4342-Insertion-11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 4e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 4e-89
Query Start/End: Original strand, 3 - 176
Target Start/End: Complemental strand, 7575018 - 7574845
Alignment:
| Q |
3 |
aagtatggcagggttactactccgcagaaaaatgtgtatttgttgcattgcagtgcaagcttagtgagttaatgttgtatagattatatttctgctgtac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7575018 |
aagtatggcagggttactactccgcagaaaaatgtgtatttgttgcattgtagtgcaagattagtgagttaatgttgtatagattatatttctgctgtac |
7574919 |
T |
 |
| Q |
103 |
taaagttggatgattgtgcattgatttatagtgtgtctggaataacgggattttccacaaacgcacgtctagtc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7574918 |
taaagttggatgattgtgcattgatttatagtgtgtctggaataacgggattttccacaaacgcacgtctagtc |
7574845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University